Markers

List of RI markers which we placed on the Lister & Dean RI map (maintained at NASC)
Updated with SNP infos on the respective PCR-markers (04/2001, info created by Thomas Rosleff-Soerensen)

(Not yet complete - I created this page as a "quick hack" to allow some people access to data they specifically asked for. If you suspect that we may have a marker you would like to use don't hesitate to contact me by Email. BW)

AtMYB3R
- Marker symbol: AtMYB3R
- gene name: AtMYB3R-1
- Gencode/GenID: At4g32730
- ID of sequenced BAC: F4D11 (AL022537)
- synomyns: PC-MYB1
- type of marker: CAPS
- gene sequence accession numbers:
- Ler: AF189212
- Col: AF188677
- sequence PCR primer 1: 5'-TGGTCTAGAGTTATTGACCCATAACATG-3'
- sequence PCR primer 2: 5'-AATTTCTGTTATCTCTGGCTATGGAAG-3'
- PCR conditions: 3min 94C (30sec 94C, 1min 60 C, 2min 72C) x35, 5min 72 C
- length of fragment: 1.13 kb
- polymorphic restriction site: BtgI (C/CRYGG, only present in Col)
- corresponding SNP: ggaaaagttccagctttacc (g/C) tggcatccttcaagttctga (C in Ler; position 77914 in sequenced BAC)
- Ler restriction pattern: 619bp + 511bp
- Col restriction pattern: 619bp + 310bp + 201bp
- reference: The Plant Journal 21: 231-235 (2000)
- raw data table (not available yet)
- note: the marker maps close to g3088 at the bottom of chromosome 4.

BW29
- Marker symbol: BW29
- gene name:
- Gencode/GenID:
- ID of sequenced BAC:
- synomyns: none
- type of marker: CAPS
- gene sequence accession number:
- Ler:
- Col: AF062872 (cDNA, but polymorphism is in intron)
- sequence PCR primer 1: 5'-GGAGCATGGACTGCCGAAGAAGACAAGA-3'
- sequence PCR primer 2: 5'-ATTGATCCACGGCATCACAAGGTTCTC-3'
- PCR conditions: 2min 85C (40sec 94C, 1min 65 C, 2min 72C) x40, 5min 72 C
- length of fragment: about 1.3 kb
- polymorphic restriction site: Taq I (only present in Ler)
- Ler restriction pattern: ca 365bp + ca155bp (plus other bands)
- Col restriction pattern: ca 520bp (plus other bands)
- reference: unpublished
- raw data table (not available yet)
- note: You can change the second primer to something from the Col cDNA sequence, but the above was what we did. If you change the primer to e.g. gtaccggagataaccagcagtgac (my on-paper guess, please check against the database!), you should loose the additional sites which cause the "other bands" except a dublet (two sites within 15 bp) which I would use as internal control for the digest.
- note 2 (from Saijun Tang 20020527): BW29 also works between Col-0 and Ws-0. I guess the TaqI digested pattern in Ws-0 may be identical to Ler-0 although I did not inlcude Ler-0 when I did the comparison. To distinguish heterozygot's from Col-0, I recommend running a 4% gel instead of 1% agarose gel (if one just wants to distinguish Col-0 from Ler-0/Ws-0, 1% is the better choice).

BW54
- Marker symbol: BW54
- gene name:
- synomyns: none
- type of marker: CAPS
- gene sequence accession number:
- Ler:
- Col:
- sequence PCR primer 1: 5-TTGGATCGGTATACTTAGTTGATTACG-3
- sequence PCR primer 2: 5-TGTTTGGTGTCCGAGTCACTGCGTTTGC-3
- PCR conditions: 2min 85C, (40sec 94C, 1min 65C, 2min 72C) x40, 5min 72C
- length of fragment: 1.2kb
- polymorphic restriction site: Mun 1 (only present in Col)
- Ler restriction pattern: 872bp + 322bp
- Col restriction pattern: 872bp + 184bp + 138bp
- reference: unpublished
- raw data table (not available yet)

CFI
- Marker symbol: CFI
- gene name: chalcone flavanone isomerase
- Gencode/GenID: At3g55120
- ID of sequenced BAC: gene located in the overlap between T26I12 (AL132954) and T15C9 (AL132970)
- synomyns: CHI, TT5, tt5,
- type of marker: SLP
- gene sequence accession number:
- Ler: M86358
- Col:
- sequence PCR primer 1: 5'-AAGCTTTAATAGATAAGAAAAG-3'
- sequence PCR primer 2: 5'-CGCCCATGGTTGAGTCGGTTGG-3'
- PCR conditions: 2min 85C, then 40 x (40sec 94C, 1min 55C, 1min 72C), 5min 72C
- length of fragment, Ler: 660bp
- length of fragment, Col: 610bp
- corresponding SNPs:
- SNP1: gcatatttaagggctcaaag (c/T) ttcaaccaccaattgtcaat (T in Ler; at position 3 (BAC T26I12) and position 84493 (BAC T15C9))
- SNP2: tcaataatatgaaagataac (g/A) atagaaaatatttgaaatta (A in Ler; at position 61 (BAC T26I12) and position 84551 (BAC T15C9))
- reference: unpublished
- note: The sequence of primer 2 does NOT fit the genomic sequence exactly, but the above is what we used in our mapping experiment (the primer introduces a NcoI site). I suggest that you change the sequence to that of the real genomic sequence:

DFR
- Marker symbol: fm4
- gene name: Dihydroflavonol 4-reductase
- Gencode/GenID: At5g42800
- ID of sequenced BAC: MJB21 (AB007647)
- synomyns: TT3, tt3, dfr
- type of marker: CAPS
- gene sequence accession number:
- Ler: M86359
- Col:
- sequence PCR primer 1: 5'-GGTTGAAGAAGAAGAAGGAAAGCTTTGAAG-3'
- sequence PCR primer 2: 5'-CTGACTAACCATGGTTGTGGTTATATG-3'
- PCR conditions: 5min 94C, 40 x (1min 94C, 1min 55C, 1.5min 72C), 10min 72C
- length of fragment: about 1.1 kb
- polymorphic restriction site: AflII (C/TTAAG, only present in Col)
- corresponding SNP: caattaaaattaaaatatta (c/T) ttaagtaaaatgtatttctg (T in Ler; position 73603 in sequenced BAC)
- Ler restriction pattern: 1.1 kb
- Col restriction pattern: 630+450bp
- reference: unpublished
- note: We remapped this locus although it was already on the map. The 100-line set was used. For reasons which I can not explain, our marker is 3.5 cM away from the original DFR marker. The situation did improve when Mary Anderson removed the original DFR marker form the Framework marker set - this also resulted in a unique position for fm4.

F3H
- Marker symbol: F3H
- gene name: flavanone-3-hydroxylase
- Gencode/GenID: At3g51240
- ID of sequenced BAC: F24M12 (AL132980)
- synomyns: TT6, tt6, f3h
- type of marker: CAPS
- gene sequence accession number:
- Ler: U33932
- Ler (f3h-1(tt6) allel): AF064065
- Col: AF064064
- sequence PCR primer 1: 5'-AGGAACTTTGACTGAGCTAGCCGGAGAGTC-3'
- sequence PCR primer 2: 5'-CACTTTCACCCATCCTTCAGGCTTATTTG-3'
- PCR conditions: 2min 85C, 40 x (40sec 94C, 1min 55C, 1min 72C), 5min 72C
- length of fragment: 550bp
- polymorphic restriction site: BclI (T/GATCA, only present in Ler)
- corresponding SNP: tggggCatcttccaagtggt (c/T) gatcacggcgtcgatactaa (T in Ler: position 84952 in the sequenced BAC; the c given in bold is a T in Ler)
- Ler restriction pattern: 220+330bp
- Col restriction pattern: 550bp
- reference: PNAS 95: 12432-12437 (1998)
- note: There is a small problem with the sequences: we re-sequenced the Ler allele and found a few differences to the sequence in the database. We first relied on the old sequence, which indicated a NcoI polymorphism. We did not find this site to be polymorphic.

F3'H
- Marker symbol: F3prH
- gene name: flavonoid 3'-hydroxylase
- Gencode/GenID: At5g07990
- ID of sequenced BAC: F13G24 (AL133421)
- synomyns: TT7, tt7, f3prh
- type of marker: CAPS
- gene sequence accession number:
- Ler: AF271650 (cDNA)
- Col: AF271651 (cDNA)
- sequence PCR primer 1: 5'-CACTATGGCAACTCTATTTCTCAC-3'
- sequence PCR primer 2: 5'-CATCCACGACAATGACAGTAT-3'
- PCR conditions: 3min 94C, 34 x (30sec 94C, 1min 60C, 2min 72C), 5min 72C
- length of fragment: 785bp
- polymorphic restriction site: BstXI (CCANNNNN/NTGG, only present in Ler)
- corresponding SNP: cgaccaccaaactcaggagc (t/C) aaacacatggcatataacta (C in Ler; position 67665 in the sequenced BAC)
- Ler restriction pattern: 120 + 208 + 467bp
- Col restriction pattern: 120 + 675bp
- reference: Biological Chemistry 381: 749-753
- note: The marker maps to chromosome 5 arround 20 cM.

FLS
- Marker symbol: FLS
- gene name: flavonol synthase
- Gencode/GenID: At5g08640
- ID of sequenced BAC: MAH20 (AB006697)
- synonyms: U1
- type of marker: CAPS
- gene sequence accession number:
- Col: U84258 (gene), U84259 (cDNA)
- Ler: U84260 (cDNA)
- sequence PCR primer 1: 5'-GAATCCCTAATAACGTCTCCG-3'
- sequence PCR primer 2: 5'-TTACATATCCGCCATTGTTTCCGGC-3'
- PCR conditions: 5min 94C, 40x (1min 94C, 1min 55C, 1min 72C), 10min 72C
- length of fragment: 650 bp
- polymorphic restriction site: BssHII (only present in Col)
- corresponding SNP: gacgaagaaagcgtgaggcg (c/T) gcggtggtgaaagcgagtga (T in Ler, position 71705 in sequenced BAC)
- Ler restriction pattern: 650bp
- Col restriction pattern: ca. 430bp, 220bp
- reference: PNAS 95: 12432-12437 (1998)
- raw data table (not yet available)
- note: The sequence of a A. thaliana FLS1 cDNA (U72631) was also published by Pelletier et al., Plant Phys. 113: 1437-1445 (1997)

MS_1_1
- Marker symbol: not known yet
- gene name: -
- synonyms: -
- type of marker: CAPS
- gene sequence accession number:
- Col: ????? (gene), ????? (cDNA)
- Ler: ????? (gene), ????? (cDNA)
- sequence PCR primer 1: 5'- TCAAAATGTATGGTTTGCCGTCAC-3' (H2001)
- sequence PCR primer 2: 5'- TTTTCATCCGCAATGCTTCACAGG-3' (OS3)
- PCR conditions: 5min 94C, 40x (1min 94C, 1min 50C, 1.5min 72C), 10min 72C
- length of fragment: 540 bp
- polymorphic restriction site: SexAI (additional site present in Col)
- Ler restriction pattern: ca. 540bp
- Col restriction pattern: ca. 335bp, 205bp,
- reference: unpublished
- raw data table (not yet available)
- note: Since we did not find an additional SexAI site close to the polymorphic site in the genomic sequence, we added an plasmid containing a SexAI site to the PCR fragments prior to digestion as an "internal control" for the digest.

MS_3_1
- Marker symbol: not known yet
- gene name: -
- synonyms: -
- type of marker: CAPS
- gene sequence accession number:
- Col: ????? (gene), ????? (cDNA)
- Ler: ????? (gene), ????? (cDNA)
- sequence PCR primer 1: 5'- GAGAGTAAACTTGACAATTACAAGAGA-3'
- sequence PCR primer 2: 5'- TTCCCAATTTTTTCCAAGTTTTTAGGG-3'
- PCR conditions: 5min 94C, 40x (1min 94C, 1min 50C, 1.5min 72C), 10min 72C
- length of fragment: 1440 bp
- polymorphic restriction site: HincII (additional site present in Ler)
- Ler restriction pattern: ca. 455bp, 385bp, 360bp, 240bp
- Col restriction pattern: ca. 840bp, 360bp, 240bp
- reference: unpublished
- no raw data available
- note: -

ms100
- Marker symbol: ms100
- gene name: -
- synomyns: WIP1
- type of marker: CAPS
- gene sequence accession number:
- Ler: -
- Col: AC018460 (not yet available)
- sequence PCR primer 1: 5'-CATACCTGAAGATTGTTGTAGCG-3'
- sequence PCR primer 2: 5'-GTACGTAAGTCACACAATATGATTC-3'
- PCR conditions: 2min 94C, 40 x (30sec 94C, 30sec 55C, 1min 72C), 5min 72C
- length of fragment: 840bp
- polymorphic restriction site: MaeIII (only present in Ler)
- Ler restriction pattern: 90 + 260 + 490bp
- Col restriction pattern: 350 + 490bp
- reference: manuscript in preparation
- note: The marker maps to chromosome 1 around 57 cM.

Please let me know if there is a mistake, if a link does not work, or if there are other problems with this page and/or the data it contains.